Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048E07
Clone ID D048E07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048E07
Sequence
CTTTTCTTTGTNNNTCTTTAATTCTCCCCCCCTTCTCCATTATCTTCGGGGGNNGGGGGGAGAGTCGCCGGGACCATTCG
AGGTGGCAGACGCATGACACCTGAGTACAT
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83383095..83383149 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]


SPLK-Sequence tag 5SD048E07
Sequence
AATGGGATCTGTGTCTGTCCTTGACACGTGATCAAGACCAAAACTTTGGTTCTAATATTAGAATGAAAGAGAAGGCTTCT
A
Sequence Type genomic DNA
Unitrap ID UNI451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83379759..83379839 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]

 
Come back to gene ENSMUSG00000031714


For any suggestions or comments, please send an email to unitrap@crg.es