Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048D07
Clone ID D048D07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048D07
Sequence
AAGTGGGACTCTTCAACAACCGCCTCCGCTGCCGCCGCGGTCTTTCTCTGTCTCAGCTGAGGCAGCCATCTTGCTCTTGC
CGCGTGCTGGTGTTGGAGGACCCTCCCCGCTGCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD048D07
Sequence
AGGCAGCTAACAATTTTGTTTATAATTTATGCCCTGCTGCACT
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505062..108505104 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]


SPLK-Sequence tag 3SD048D07
Sequence
ACAGGTATCTGAGATGCCTCACACTTGATACAANNAGGACAGGTACATTAAAGATATTAAGTAGGGATTAAACCAGGTGA
CCTTTTAGGCTCAGGATGAGCCTAAATGTCTTTTTCTATTAGAATCCTACACAGCCCAACTTGCTGTTGGACAAAAGGCC
ATATTTCTCCTTCCCCTGCTGCTTTAAGCTTCTAGATGCCCTAAAATTATGTCTTTTCCATAAAATACTCCTTAGGAATA
AGATTTCTTAATTATACTGACCACCTGAAATGGAATTATTCTTTCATTTACACCATAAGNNAGAGTTAATTTGGGCTTTG
CTTTTGCTTCAAATAAGTCTGGACTTTTTGTCTTATCTTTCCAACTGCCAACTCTTTTCTTTAGGAATGTTACCTAAGAT
GCAAATAGTCACAAAGGGCTAGTCCTGTGCTTAGTTTTAATATTCTCTCCTGACCTCCTTTTTGCAAGAAATTCCTTAAG
TGCTGTGTTATTTCACTATAAGTTCATGGCTGTAGCTCTTTTGTGGATGTTTGAATGCAAGGTTGAGGTTTCTA
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108504505..108505060 530
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es