Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D047E08
Clone ID D047E08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD047E08
Sequence
GATCTTTCAGTTAAAGCTCACTCATTGGGTGGTGCTTGGTGATAAAGTTAGAACATGAGCCTCCTCTCTAGCGTCTTTGC
ATCATTCAGTGTTACTCCTCACCCTTCCTAATTCCTTGAGAGCACCTTGTTTAGTCTGCTGTGCTGCTTCTGGCTCCCTA
GCTTTAAAAAGCATACAACCCTAGTTAAACATCAAAGGGGAATACATAAACAAACCTATGTTTCTCTTTAGCTCTCTAAA
GA
Sequence Type genomic DNA
Unitrap ID UNI30279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 43634474..43634715 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039782 (Cpeb2) NM_175937 cytoplasmic polyadenylation element binding protein 2 Gene [Source:MGI (curated);Acc:Cpeb2-001]

 
Come back to gene ENSMUSG00000039782


For any suggestions or comments, please send an email to unitrap@crg.es