Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D047D04
Clone ID D047D04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D047D04
Sequence
TCCCTGGAAGAGGAGCACGTGCTGTTCACTGCTGATCCGTACCTGGAGCTCCACAACGATGACACACGAGTTGTGAGAGT
GAAGGTTATAGCTGGCATAGGCCTGGCCAAGAAAGACATCTTGGGAGCCAGTGATCCTTACGTAAGAGTGACATTGTATG
ACCCGATGAGTGGAATCCTNNNCAGCGTGCAGACAAAAACTATCAAAAAGTCTTTGAATCCAAAATGGAATGAAGAAATA
CTGTTCAGGGTCCTTCCACAGCGACACCGCATTCTTTTCGAAGTGTTTGATGAAAATCGTTTGACAAGAGATGATTTCCT
AGGTCAAGTGGATGTCCCTCTCTATCCTTTACCGACTGAAAACCCAAGAATGGAGAGACCATATACATTTAAGGATTTTG
TTCTTCATCCAAGAAG
Sequence Type mRNA
Unitrap ID UNI1928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72517867..72558346 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 5SD047D04
Sequence
CAGCTGACTCTTAACAAATTAAACCTTCTTTTCTCGTTCTTCAGTCTGCCTTTCATTATAGTTCAGCAGTGCTTTCCAAA
GTACTCAACCCCCTTTCTCATTTTAGACTGA
Sequence Type genomic DNA
Unitrap ID UNI3734

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72558179..72558289 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 3SD047D04
Sequence
AATCACAGTGTACTTTGTTCATATTCCAAATAAAATTCTTAAATAGACACAAAAATTAGGAATGATTTGTCCCCCTTATT
TATCTAATAGCTGTATTTCACGTAAAACAAATGTCCAGCTTGATCGGTACAAAAACAAATTCAGAATTAACTTGAGTATA
TTTTGCAAAATTTAATTTCAAAAACATTTTAGAAGATTCCCATAGAGAAACTAGCATGAATAGTGAATAAAATTNNNACC
CAGTAAGTACGCTTGGAATTCCATTTTCCTGAACTGAGATACTTGGCTCCTTTTTTTAAACTAAATTTAATCTTTAAAAA
GGACCTACTCAC
Sequence Type genomic DNA
Unitrap ID UNI29879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72558891..72559222 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es