Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D047B03
Clone ID D047B03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D047B03
Sequence
GCNCNNNGAACCCTGGCNCGGTCNNNCCGTCAGCCGTCATCATGTCCCGACAAAGCACCTTGTACAGCTTCTTCCCCAAG
TCCCCGGCACTCGGCGACACCAAGAAGGCCGCGGCCGAGGCCTCACGCCAAGGTGCCGCTGCCTCTGGAGCCTCCGCTTC
CCGCGGCGGGGATGCGGCCTGGAGCGAGGCTGAACCCGGGTCCCGGTCCGCGGCGGTATCCGCCTCGTCGCCGGAGGCAA
AGGATCTCAACGGAGGGCTGCGGAGGGCCTCCTCCTCCGCGCAGGCCGTGCCTCCCAG
Sequence Type mRNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88374455..88374745 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 5SD047B03
Sequence
GGATCTCTAATTTCTTTCCTTCCCTTTGGCTATAAAGGACACAGTTCAGACACAGGTAAACACAGAGGT
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88375536..88375604 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 3SD047B03
Sequence
CACCAACCGTCCTGTGGATAAAACTCAGGCCATCCTTTGCGTTATCGCCTANNCCATATCTTCACTGGTAT
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88375891..88375961 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es