Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D045F01
Clone ID D045F01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D045F01
Sequence
GCCGAAGTTACAGAAACTGAAGGGGCGGGTAGTTCTCTTTCCTTTTGCGGCCATCGGTGGATCGCAGCCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD045F01
Sequence
GATCCGCCCTTGCTTCCATGCTCAAGTGGGGGGCAAAATGCAGAGCACCAGAAGCGGTAAATGAGAAGGTAAAGACCGAC
GCTGTGTAGGGANNTCCCGGGATGCTGAAGTTGGAAAGTCAAGTTTAAAAGTAGGATAGGTGTTACTAATGGCAGAGTCT
TCATCTGTTTTCAGTCTTT
Sequence Type genomic DNA
Unitrap ID UNI29538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68715420..68715599 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060938 (Rpl26) NM_009080 ribosomal protein L26 Gene [Source:MGI (curated);Acc:Rpl26-001]


SPLK-Sequence tag 3SD045F01
Sequence
AAGCCAAAATGAAGTTCAATCCCTTCGTGACTTCTGACCGAAGCAAGAACCGCAAACGGCATTTCAATGCGCCCTCTCAC
ATTCGGAGGAAGATCATGTCTTCCCCTCTTTCCAAAGAGCTGAGACAGAAGTATAACGTTCGGTCTATGCCCATTCGGAA
GGATGACGAAGTTCAGGTATGTGTCCTTGCTTGGCGAGGCGAAGTTAATGGAATTTTACGATTATTT
Sequence Type genomic DNA
Unitrap ID UNI29538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68715769..68715996 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060938 (Rpl26) NM_009080 ribosomal protein L26 Gene [Source:MGI (curated);Acc:Rpl26-001]

 
Come back to gene ENSMUSG00000060938


For any suggestions or comments, please send an email to unitrap@crg.es