Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D045E04
Clone ID D045E04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D045E04
Sequence
CGGCGGAAGCCCTCGCGGTGCAGTGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGC
CGCAGTCTGGGTACCTGCGGGGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGCTTTCCAGGATGCGGGG
CGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTGCTGTAGGAGTCGTTAGGCTCGGCGCTACCTGAAGCG
GAAGCCGCGTTCACCCAGATCGTCTCCTGTGTCGCGCTTTAAAGT
Sequence Type mRNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56037614..56037898 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]


SPLK-Sequence tag 3SD045E04
Sequence
GCCCTTATCCTAATGGAAATAGTCTTTAGTTTCTGGTGGGGAAAACAAGTATTATCATAGGCACAGGGNNCTCTGAAAAA
CTAATAGGATTGTTTGCTCTAAAGTGGGAAAAGAAGATGTGCAGCTGAAAAGGCAGGCAAGCAAAGGGTGATACTGCAAA
AACCCGCTTAAACCACATGAGTGAACTTGG
Sequence Type genomic DNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56036839..56037029 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]

 
Come back to gene ENSMUSG00000044763


For any suggestions or comments, please send an email to unitrap@crg.es