Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D045D06
Clone ID D045D06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD045D06
Sequence
AATCTGAAAAAGGAATTGTTAAATGTTAACAGGAGATTGTTAGAAACTCTGGCT
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649606..66649659 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


SPLK-Sequence tag 3SD045D06
Sequence
TAAACGGTGAGCTTTAACGTGTTTTGTCTGAGCAGCTGAGTTGTATTTGAGAACTGTAGAT
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649695..66649755 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es