Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D045D04
Clone ID D045D04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD045D04
Sequence
ACTTTTGTTTTTGTTTTTAATTTCTATGGTGGTGTGAAATTTCTTTCTACTAGTTACAAAGGCAAAAATCAACTATATTG
TTTTTATATTTTTTTTTTAAGTAGGGTCTCATGGGCTGGAAGGCCTACAATAAGCCTTACCCAGGATGATAACTTTGTCA
AACTCAGGTCCTGAGGATTCTAAGTTAAATAATAATTCTCAAAGTCTGATATCA
Sequence Type genomic DNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56037159..56037372 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]


SPLK-Sequence tag 3SD045D04
Sequence
ACTGGATAGGCCAGCCCTTATCCTATGGAATATAGTCTTTAGTTTCTGGTGGGGAAAACAAGTATTATCATAGGCACAGG
GNNCTCTGAAAAACTAATAGGATTGTTTGCTCTAAAGTGGGAAAAGAAGATGTGCAGCTGAAAAGGCAGGCAAGCAAAGG
GTGATACTGCAAAAACCCGCTTAAACCACATGAGTGAACTTGG
Sequence Type genomic DNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56036839..56037043 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]

 
Come back to gene ENSMUSG00000044763


For any suggestions or comments, please send an email to unitrap@crg.es