Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D045A05
Clone ID D045A05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D045A05
Sequence
GGGCTCTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGGCATTC
GCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444749 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SD045A05
Sequence
GGATCTCACCAAGGGAAGCAGAAGCAGCCTTCTACTGTACTGAAGGAAGCCCCATGAGCTGTCATGTAATCTTGGGAAAT
GTTAGAAAGAAAACTACTCAAGACCTGGGCTTCTGAATGGAGCATTGGAGGCCTCTACAATGTGAGAGAGGCCTTACTAG
ACCGGAGCACATGTTTGTTACAGGAAGCCGAAGTTAGAGTCCAGAAGAATGGCTTCCTAGCGTTGTGTCTGTGTGCTTAC
ATAAATAAGAAGCTGCTTGTATGGGGCAAAGCTGAGCGTCTATCCCGGCATTATCTGCCCTCAGAGCAATGTGGCTAGTG
TTCACGTTGCGACCTCTTTCTGGTTTCCTTAAGTAATATGGGGGACAGTGAAGGAATATCACTGTAGTTAGCGCTAGGGG
GGGAAATTCTTAAATGCCTTCGTGAGGGGACTGGGGGTGGGGCCCTTGTAGGCACGAATGCCTGGACTTTGGCTCCTGGT
CCATTTTTAGGAAGAAATGGACGGGGCAAGGAGTAAAGG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180437154..180437672 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SD045A05
Sequence
CCCTGTAGGGCTGGCGCCCCTCCCCGCTCTCACACGCCCTGCCATAGGCGAGAGCTGCAGGGCTTTGAGGTTTTCCTGGC
TCCTTCCCACCGGAATCCGGTGCTGGTTTGTTCCGAAGCACCAGTCCCTGCAGACACAGAGTTTAAGCTTTTGGAATGCT
GGGCCGGGTGCTGTTCAAGGATAGCTGGAGGAACCTTTTAGTGGCATTGGCTCCCAGCTTAGCCCCTTAGTTCGGGACGC
GGGAATCTGTCAAGCGTGCCCGGCCAACCAGGCTGGCGCTCCGGGGAACCCGGGTGGCGCATGCGTGCAAGAAGGGCGGC
ACAGCGGCTCTAGCCTCGCCGTAGCNCNNNGGCCGGTCGATTTCTTCGGCTTGCGGCGCGGCCTACCACTCTAGGACGGA
AGTCTCGCTGGTCTCTGCTCTATATCCGTGGAAGCTCTGGAANNNNCTGCGG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180436682..180437134 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es