Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D044D02
Clone ID D044D02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD044D02
Sequence
AAGAATGGCTGTGGCTGAAGGTTTCAGTTCAAGTGTAATTGGAGATGATGCTCAAAGCTGAAGGGTTCCCTCACCCCAGG
GACTAGAAGACAGAGAAGGGCTCCCTGGACCATTTAACTTTAATAACAAACAGCTCCCTTCTGGGATTTCTGGTCTCTGT
TTCATGGTGGTTTTGCTGAACAACTAACTCAGGAAAGCCGGGAGAGGGCTTTGGGGGCAGCCAATACTGTATGTACTTCA
GAGCTTACAGCCTTCCCTTCTGGAAATTTTTCAGTCTGGGCAATGAGAGGTGCTCAGTCACTGCTACTGGTGGTGCTGGG
AGCAGGGTGGGCCTTTCNNTAGATGAGCACAGGGGCTGGAGAAAGGATGGGAGAAAACAGCCAAAAGCCTTCGTAAAGTG
CCTCC
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17243443..17243845 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


SPLK-Sequence tag 3SD044D02
Sequence
TGGGNTGNNCTTTGGATGTGATAAGTCATCCTAAACTCCAGAAGGCCAGGTGTGAGCCTGAGGCAGCCCCCATCCTGGCT
GAGGGGAGAGGATTGTTTCCAAAGTCCCACATTCCATGCATGTATGGACTCTGATAAGAGCAGCACTGCTTGCTTGCTTT
GGGTTGAAGGGGACTTTGACTTCATGCCCCCAGCAGGCAGCAGGCTCATCCACATCCTGCTTCCTGGTAGCACCCTTCCC
CCACAGGTCTCTTCCTTCCACAGCCCAGACCTGAGATTCATGGATGCCGTTTCAAACAGTCCTTTCATTCATTTATTTAC
TCTA
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17243866..17244189 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es