Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D044A04
Clone ID D044A04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D044A04
Sequence
AAANNNCGNNNNGGTTCNNNGAGACCCTGCGAATTACCTAGATTCCTGAGAAAACGCGGCCACCCAGTCGACCAGGGCCT
AACCTTTTGCTTCCTGGGGCTTCAGAGAGCCTGGGCCCCACTGTCTGGGAGGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD044A04
Sequence
GGGCTTCATTCTTTCATGACTGGCTACAGAAAAAGCCCCCTCAATTCATTAATCCCTGGGGAGATAGAAATACTATTAAT
AGCTTACCCTCTACATGAAATAGAGCATGTTTTATTCACCGTGTATGAGCTAACTTAGCTATTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71019469..71019616 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es