Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D020A09
Clone ID D020A09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D020A09
Sequence
AAAAGTGCGTGAGGAGTTCAAGGAGCTGAAGGCTCG
Sequence Type mRNA
Unitrap ID UNI10494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88306670..88306704 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es