Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D043E12
Clone ID D043E12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD043E12
Sequence
GATCTTTTGATTAGAGGTTATTAGAATTAGGCTAAACCTTTTATGAGTGGAGGTAGAGAGAAGGGCTTGAACAAAGGTCA
AAAGGGCTGGGTGTGGTGG
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29142498..29142596 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


SPLK-Sequence tag 3SD043E12
Sequence
AAGGNGGGTTGATCTGAGGTGGANNCACCTTGCCTACATAGTGAGCCTGGGAAGGAGAGCCCAGTGCTTAGCATTGCATT
AGGTACTGGCTGAAGAATAAAAGGATTCTGCTGGCCTGTTATATTTGACATCTGCGAGCGCACATAATATCCCATTGACC
T
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29142314..29142475 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag D043E12
Sequence
CACCCCNNNCCCCCTCTGGAGGAGGAGAAGGGGGTACGGGGGGAGCCTNNGGCCCTTCGTACCGGCCGTTTTCTCCGGCA
GGGGGGGATCCTCCCCTTGTCCCCTTTCCTTNNNGGATCGGGAAACTGCCCTCAGAAGGAGTCCCCCGCGTGTCGCGGTA
GCTCTGGAGNNGNNCGCACCTCGCGTCNNCGCCTCNNCNGTAGCCGTTGNNNCCGCGCCTCCCTCCCCCCTGGGTCTG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es