Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D043D07
Clone ID D043D07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D043D07
Sequence
CAAGCTCTCTTTCCGCGATGGTCATAAACCCAAAANNNCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTTAGCTAGAT
GGTCAGATGGCTTGTTTGATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGAC
AGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAACAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509925..108510237 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SD043D07
Sequence
TGTCTATTATGTTAAGACAGAACTTTAGTAAAGTTTTAAATACCTAGTATTTATTTGTTTCTATGAAATGATATATTCCT
GCATTGCTGTTGACAGTAAGTTTCTGTTTTGGCTATTTCAGTAATTGC
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108511714..108511841 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es