Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D043D02
Clone ID D043D02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D043D02
Sequence
CTTNTAANNNTTCCCCCTTTTATAAACAAGTTANNATGATGTGTGGTCCGGCGGGCTCGAGGAGGAGCTACGCGCGGCCA
G
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD043D02
Sequence
GATCTGTACTCTGCAGTCTCAAAACTGTAAATACTCAAGGGTTGGTGTTTGG
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109120137..109120188 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]


SPLK-Sequence tag 3SD043D02
Sequence
AAAGAAACACCGACATGAGGCGTTTTCCTGAAGACTTTTCATTCCTTTCCAGATTCTCAGGACTCTGAGTCAGAAATCTA
GGTTACAAAGAGAGTGCTGTTTGTGCAGAGGGAGAGGCCTTAGCTGAATGTTAGGGCCTTAAACCAAGTGGAGAATTCAT
CCAGTCACTTCATTTGCTTTTGATTGCAGAAATGCTGAGAAACAATTGACTTGTCCACACGGCCTACTCAGGGCTTTCCC
CCATAATAGAGAAAAGATAATGCTTTTCTTGGCCTTTTTTCCCCCTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es