Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D043B12
Clone ID D043B12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD043B12
Sequence
GGCTTTGGGGATACTACTACGACTACCAGATGCGCAGTGCATGAGTCGCGCCTTCTTTGTATGTGGGTTGAGACCCTGTT
CCATCTAGGGAAAGTGCTGCGGGACACCTCTGTTCCCTCAGCCACATCTGACCCTAGCGCGGCGGAATTGACACCTTTAC
TCACATTCTCTTGTGGCTGGGTCTCCACACCTAACTGTCCTTTGGCATTTGAAAAAGGAGTCGGGCCCCGTTCTAGGCAC
GTGTCTCCCACCTTTCTGTCTGGGGTAAATGGCATGCGTTAGGA
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102825126..102825408 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


SPLK-Sequence tag 3SD043B12
Sequence
AGCGCTGGCCTACATTGTGCAATGAATGGCTTTNNCTTTGTCATGTATCTATCTAGTGTGAGAGCCCCAGTCGGAGAGCA
AATTAAATTGGAAGATTTGACCGTCGAACGTTTCAACCATACCCAATCTTAGTGCCCCGGTTCTTTTGCTTTAAAGAGTT
AACCTTAGAAACACCTTTGTGGCTGGTCTCCAACCTGACTCACAGGTGAGCAGGGAGTACTCCTTAACACTTTCCAATGC
AGAAAACATTCTGAACATTATTAAACCACTTAGTTTCCTTGTTCTGCAACTAAAATGAGCAAAAAGATAGTGCTGTTTAC
GCATATGGGCAGCACGGGCATAAATCAACTACAGATGTTTAAAGATTGTAGTTGAGTTTGCACATTATGTTAGGCTGATG
TGAACTTCTAGCACNCGAAACTGCCAAGGTTGTTTTTCTTTTGTTTATTGGTTATAGCCTTAAACTGTGCAACCTAGGTT
AGCCTTGAAATGGCTGGCTGTCTAGACTGCTTGCTTGCTCTAACCTACTTTTTAAAAAAATAAGTTCCAAATTATAGGGC
ATTAATTCAAGCTACCAAAATGCTCAGTCTTGCCTCCCCACCCCCTTTCTTTTCC
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102825440..102826053 567
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es