Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D043B01
Clone ID D043B01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D043B01
Sequence
CGCNNNCNNNTCAGGTCGGGCGCCCAAGACGAGGGGCCTCTGGCAGGCACCTGAG
Sequence Type mRNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17233779..17233823 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


SPLK-Sequence tag 5SD043B01
Sequence
GACCTTACAAGACATCTTTGTGCCTTTGCTTTTCCTTGTGTGGCGAGAAAGAGACAGGTGTCGACACTAGTGGCCTCCAG
AATTCCCACTTTTACATTCCTAGGGGGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD043B01
Sequence
TTATTAGCTCCTGTTGTGTTACAGGTAATCTGTCTTTTTAAAATAATAACTCATCATAATCTCAAATTATTATTTCATTG
TCAAGGGGACTCACCTGCTGTCGTCAACTAGAGTGCCCTAGAGTTGG
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17250730..17250856 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es