Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042H07
Clone ID D042H07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD042H07
Sequence
TTACACACAAACACGGAAATAGCACTTAAACAAGAAGCCCCCAAGGCCGAGCTGGGTTGGAGATGGGAAATCCCACGTTA
GTGTAGTGGACAGTGTGAATACTTTTGCTCAGGCCGGTGGGTGAGTCATGTGCCTCTGCTGATTGGCTG
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32420392..32420540 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SD042H07
Sequence
CGAAATCTGGTGAGATTATCTCCTGTGTGTGTATATATGTTGGATGCCAGTTGCAGCAGCCCTCTTGAGAATGTCTTTAC
TTATCATCAAAGGTGATATTAATAGCCCCTGGTTACTAAAATCCAACTCTCAGTGTACTTCTAAGCCAATGTGCTCTTCA
GTGCTATAATAAAAAATTGGAAAATTTTTATGAATGGAGATGTCAACTTCCCTTGGAATTGGTAGAGCTTGGGTGTTGTA
AAGAATGTCACCCACA
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32420051..32420306 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es