Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042H04
Clone ID D042H04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD042H04
Sequence
TTGCCCATTGAGTCCCAGGAGATTTAGACATTAATACTGTAGGCTGAGTCTTGTGCCTGGGATGTAAGGCCTTTCTAGAT
ACCCTAAATAATCTGGGCAAGAACGCCATTGCGTGATATGCTGTGTGGTAATGCATGATGAGTTGACAATTTGACCAACC
TAAACTAAATGTAATTATTAATTTTTCTTTTAAATATGGGCAAACAAAAGTTTCTGTATT
Sequence Type genomic DNA
Unitrap ID UNI21706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100405259..100405478 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]


SPLK-Sequence tag 3SD042H04
Sequence
AATATAAAGGTTACTTGATAAAGATACTGCGTGTTAAAATGTCTTGCATGTTATACTGAAGTATTCTGTCAAGTAGACAG
TTCCTTAAGTATTACTATGCTTTATGCAAAGTCCTGTATACTTTAAGCATTGTGTATATATTCATAGGTGGGCTAAATGT
GGCTTTCCACTACAGCTCTTATCAGGCTTTTTATTTTCAGTGTGATTTGGCTGGGATGTTAATTACAGTTGGTTGACATG
TGTTCACATTTGCATGACTTCCCTTGGAGGCTGGTAGGTTGAGCATTCTTTTTACCCCACTTCTCCCCCCTGAAATGTCA
GTCTCTGCCCTTAGGGTCATACTTTGATCTTTACCATTGGAGGTTAGAAAGCCAGTACATTGCCTATGTCTGTACAAACC
ATATTCTATTAAGTTATTTTGGATAACAC
Sequence Type genomic DNA
Unitrap ID UNI21706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100404773..100405201 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es