Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042G12
Clone ID D042G12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD042G12
Sequence
CCCCACACCTTCCTCGCCCCCTCCGGCTGCTCACGGTGGGGCAAAGGCCCGNNNGGATGTTTTGATGCCGAAATCGCTTC
CAAGCGACAGTAGACCGACCACCTTTGTATTTTTAGCTGTTCCTGAAGGAGGAGGAAAAAACGAAGACGAAGAAAGGAAA
TACTAGTATGTGCAAGTTTGTAACTGATAAAACCTTGAGATGCTGGTGATGTGAGGCTGCAGGCTTGATAAATGGCTTGT
TTTCATTCATTGTGA
Sequence Type genomic DNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12650119..12650374 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


SPLK-Sequence tag 3SD042G12
Sequence
TTTGGGAAAAATTTTGGTTCCGGTAAGAGGAGGGGCACCCGAAAAAATTTTTTTTTAACCCTAAAACCNCACAGCCCTGC
ATCTCCCTTTTTTTGGATAAATTGACTTATGAAGAAATATTTTGGGGTGTACTTACGTGGGAACTCTGTAGCCANNNATA
AAAGAGCTCATTCGCTTCATTTATTATAAGGATTGGGNNACCATGACTAGGGTTGACACTTGAGCTTATTAAAAATAGAT
ACTACAAACTCTTCTTTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es