Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042C04
Clone ID D042C04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D042C04
Sequence
AAAAGAAGAGAAAGGAAAGCGCGAGGAGACGCCGCCGCCGCCACCGCCACCGCCACCAGCGCAGCTGTGCCACAGCCGCG
AGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGTGTCCTCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD042C04
Sequence
AAAACTTTGCTAACTTTCCTAAGCTTCTGTAGTAAGATTTGGTTGTACTGTCAAAGTAGAAACATTTGCCAGCAGGAAGA
AAAATTGACCTTGGTCATTTCATCA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30072035..30072139 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SD042C04
Sequence
TTTTTTCGTCCATATATGTTGCTCTGGNCATCTATCATCATTATTTTTGTTATTACTATTATTATTAAAAATTTTTTGAG
ACAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es