Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042B04
Clone ID D042B04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D042B04
Sequence
CCCCCCCNNNCTTGGAGGANNNGGAAAATTAACTAACAACTTCTGGCTNNNCGGGGGGCAGCGTGCCAACCAACAAGATA
ACTGTCTCCCAGTTTTGTTCAAAACTACTAGTGAAGAAGTCCTCCTCTCCTCTCATTCCCATATCTGCTTTCCGTCTGGA
CACAACATTGGGTCTAAGAAAATCAGCTCACCAGGCTGTGACCACTGAATCACATTGGAGTTCTCTGTG
Sequence Type mRNA
Unitrap ID UNI5569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32389987..32390145 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 5SD042B04
Sequence
GATCCAGAAGACAAACAGTCTGCAGAGGCATACACTTAGGCCTCTAGATACCTAGGATGCACTCTGGAGGGGCTGGTTAT
CATTGCCCTCTCCCTGGGACAAGAGGAAGGCAGGTTAGATTAAGAAAGCCTCAAGAGAAAACAAGACAAGTCCTATCTTA
ACCTGATTTTGTTTTTCCTGTACTACTTCCATCTTCTCTCTTACTAGTGGGTCCTTGATTTTTGAGGGTT
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32375627..32375856 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SD042B04
Sequence
CATAGCTCTTAGTAAGTGATTTTTGTTTGCTACTGTTTTCTGCTTTTAACAGTTGTCATTTAAAATGGTATAGGGTTTAT
TTCAACCCTTACTCATGCAGGAAGTTACCAAGAAGGTATCAGTTTAAGTCCAAGCACCCCCTCCCCCCCAACTGACTTGA
TTAGATTGTCTGCACAGTAAAAACAGGCATTGGCTGAGGACTCCCTGAAGGTGCTTGACTGGGTGGCTTTTGGCT
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32375336..32375571 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es