Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D031E08
Clone ID D031E08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D031E08
Sequence
CGCCCGCGGCTTTCCTCGGTCAGGNCTCTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGAATGCCTGTCTGG
GGCGGTGGAAATAANNNNNGGTNNTTCTTTATATCCGTGTCCCCCGCGGAAGAGGTGCANNNNNNNNNNNNNNNNNNNCA
TCGCTGCTGCTTCCTGTGCA
Sequence Type mRNA
Unitrap ID UNI10495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110357244..110369123 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


SPLK-Sequence tag 5SD031E08
Sequence
GATCTGCTAGTACGCACTGTCTCGTGGGCTGAAGCAGNNNGGAGGGAACTCGTAAAACAAGCATCCTAATGCATCCTTTG
TTCCGCAGAATGCCTGTCTGGGGCGGTGGAAATAAGTGCGGGGCCTGCGGGAGAACCGTGTACCACGCGGAAGAGGTGCA
GTGCGATGGGCGGAGCTTCCATCGCTGCTGCTTCCTGTGCAGTGAGTATGGTCCCCTCCCCCTTCAGTTCACCTCTGGAA
GAAAAATAACAATGCTGCTAAGAG
Sequence Type genomic DNA
Unitrap ID UNI10495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368923..110369187 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


SPLK-Sequence tag 3SD031E08
Sequence
AACCGCTGAGTCATCTCTCTAGCCCAATGNNCNNNTTTTATGTCATTGATCTTAAGACGCTGAGGACTGAGCCAGAGGGA
AGACCACCTAGCCCTCAGTTCTGGCCAGTTGGNNTTAGCCTTTGTCACCTCTGTCTGTGTCCTCGGGACAATCTGGCACC
TACTGAAAGTTTCTGGCACACCCTGTGTGTTTGGCTTGATTCGGTTAATAAGTTGATCTTTGCCACTTTTCTCTTTCTTG
CTGGGCTCCCTTCTGAACACCAACAACTGAAGTTCAGAGTATACAAGCTTGGTTTCTACAGAACCTTCAAATTTGACCTT
CTATAGCCGG
Sequence Type genomic DNA
Unitrap ID UNI10495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110369235..110369564 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es