Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042A03
Clone ID D042A03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D042A03
Sequence
GGGGCTAAAATTTCCCAACTCCNNNNATTGGTGGCGGAGAGGGGGCAAGTCACCAGGGCTCTTCCCGGCGCCCCAATGCG
CGNNNCATGTCGACGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGGCCAGGGCGAGCAGCCTCAGCAGCT
ACCGAGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCCG
Sequence Type mRNA
Unitrap ID UNI1046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592412..168592615 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


SPLK-Sequence tag 5SD042A03
Sequence
GATCCGGGCCAGCGTGGCCTGCGGGACCCTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD042A03
Sequence
TCTTGTGTGGTTCTTTTAGAGAAACAAAGTTATTTTGGGGTGGTTTACTGTTTTGTTTTATTTACGTGGAAACTTGGTAG
ATCAAGAGCTGTTGGTGATTGTTAATTAATGTGGGAATTGTGTGCAGCCAGTTGCTGAGGTAGACG
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168586399..168586545 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es