Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D041E11
Clone ID D041E11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD041E11
Sequence
AGCATAAGGATTTTTTTCGTGCTATTCTGGTTATATGGATGTATAAAATACAAATCAAATATTAACTGATAATTTCATAA
CAGCCTTCTCCTATAAATACAATTTTACC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180442737..180442845 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SD041E11
Sequence
GCTTGCTTCTTTTTCCATTCCATTAAGTGTTAGCCTTGGGGCTGGAGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es