Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D041E07
Clone ID D041E07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD041E07
Sequence
GCCATGCATGTCTAAGTACGCACGGCTGGTACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATGGTTCCTTTGGTCG
CTCGCTCCTCTCCTACTTGGATTGAAAGACNGCCGCGACGCGTAGCATCTCAGGGCTGCC
Sequence Type genomic DNA
Unitrap ID UNI21917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18337772..18533377 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013539 (D16H22S680E) NM_138583 Ser/Thr-rich protein T10 in DGCR region [Source:UniProtKB/Swiss-Prot;Acc:P54797]


SPLK-Sequence tag 3SD041E07
Sequence
GGAAATTTTNNNNNNNTGCACAGAACGGGAATTCAGAAGCAATACATGCCGACGGCGCTGACCCCCCTCTCCGGGGGGGG
ATGCGTGCATTTATCAGATCAAAACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGNGGCCGGGCGCCGGCGGTTTTG
GTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGACCCATTCGAACGTCTGCCCTATCAACTTT
CGATGGTAGTCGCCGTGCCTACCATGGTGACCACGGGTGACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAA
ACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAAATTACCCACTCCCGACCCGGGGAGGTAGTGACGAAAAAATAA
CAATACGGGACTCTTTCGAGGCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTAACGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013539


For any suggestions or comments, please send an email to unitrap@crg.es