Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D041E02
Clone ID D041E02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD041E02
Sequence
AAAACAAACCCTTAGTGTTNNNTCACAGCAACAGAGAAGCAAATTAGAGTAAGATCAGAATTTTAAATGATATAT
Sequence Type genomic DNA
Unitrap ID UNI30287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87563077..87563151 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]


SPLK-Sequence tag 3SD041E02
Sequence
AAAGTCCTGCTCCTGAAACTCAGCCATTCACTTGTGT
Sequence Type genomic DNA
Unitrap ID UNI30287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87563392..87563428 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es