Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D041D09
Clone ID D041D09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D041D09
Sequence
CGGACCTCAGNNNAAAATCCCCTTCCCTTCGGGAAAGAGGAAAAGNNAAAGTACGGTGGACGGAATCAAGAAACGCCGGC
TCCAATACTGCCTATACACAGAATNNNCCTGAAGAAGTAGAATATTTCAACCATAAAGACATCTTAATTGGGCACGAAAG
AGATGATGATAATTCTGAAGAAGGCTTCCACACTATTCATTCAGGAAGGCATGAATATGCATTTAGCTTCGAGCTTCCAC
AGGC
Sequence Type mRNA
Unitrap ID UNI10900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81023030..81026746 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]


SPLK-Sequence tag 5SD041D09
Sequence
AATGAAGAAAAATGGAAAGTAAGGATTTTTATTTTAGCCAGAGGAAATAATGAAGTTGATAATGGAACTCATAGCTTAAG
ATGAAAGCTTGTGGCTTCGATCATGAAGAACATCTTGAATAACAAGATTTTCTTTTCTTGTGTTTTTCATTTTAGATGAT
GATAATTCTGAAGAAGGCTTCCACACTATTCATTCAGGAAGGCATGAATATGCATTTAGCTTCGAGCTTCCACAGACGTA
AGTATTCTAAGGAATAGGTATTTTCTATGGATACTTTTAGTCAAGCACGGTCTTATAAAATTAGATACTCCATATTTAAA
TACGGAGTTTTTAATTTTTTTAGTTTAAAAAAACCCTTTTCATTATAGAAACTTGATAGAGGAAAACAACATATTAAATA
GGAGCTATTTTTAATCTCATGTGGCAAAATTACAG
Sequence Type genomic DNA
Unitrap ID UNI10900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81026512..81026946 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]


SPLK-Sequence tag 3SD041D09
Sequence
GTAGTGTTTGAAGCTTATAAAACAGTACTTAATTTAGGACTGGTGATTCAGTAGGTGCTAGTCAAACAGTAAACCTTCAA
TCAGCTGCTTATTATTCGCTGTAGTAGAAGAAAGCTGAGGCTCACTGGGTTAAAATTCAGTATTCTGTCTTTTCTTCTAT
TGTAAATGATTAGCAATAAATTTAGAATGTAAAGATAACACTCAAGGAGAGGTCTGTTCTTTAGACACACATTCCATAGC
TTTGTATACAGAGCTACTGAGGACATTACATAAGCTATCATAACCTGGACTTAAAAGGAAACGTCTGTCAGAGCCACCAG
AGTGGAAAGCTTGAAATACAGTACATTCTTAGCATTTTAACAGATTGTTGAGATAGAATATGTAAACATTTTTGCATAAT
GCCTCTTAAGACACTGGAGCCTGTAAACTGGCACCTGCATTGATCTAGAGAATGAATTTAGCTCATATCAGTTTATCAGG
CCTTGGCTGTATCTTAACTTTGTGTTTACTCGTTCTGAATTAGAATTTTGTGTAGAGTTCATAACCATTGTAAAATAGTG
GCACTTCTACCGGGATAATCTAGCTCTCTGGCTTGGAAGTAACAATGCTGAACATTTCTCTAATGGGTCAGGCTGCTTCT
NNNAACATTTTATAAACACCAAATCCTACAATCTGG
Sequence Type genomic DNA
Unitrap ID UNI10900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81026975..81027650 668
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

 
Come back to gene ENSMUSG00000074794


For any suggestions or comments, please send an email to unitrap@crg.es