Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0085
Clone ID CE0085
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0085
Sequence
GGGGGGCCTTAACAGTTGACCACGGGGATTGAAGTTGAATTTTTTTTTTTTTTTTCTTCCCTCCGGCCAAGATGTCTGAC
ATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTACGACCTGGAGTACTCTGAAGACAGTAACTCTGAGCCCAATGT
GGATTTGGAAAATCAGTACTATAATTCCAAAGCACTGAAAGAAGATGACCCAAAAGCAGCATTAAGCAGCTTCCAAAAGG
TTTTGGAGCTTGAAGGTGAGAAGGGAGAATGGGGATTCAAAGCGCTAAAACAGATGATCAAGATTAACTTCAAGTTG
Sequence Type mRNA
Unitrap ID UNI1210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125673943..125684738 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027206 (Cops2) NM_009939 COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) Gene [Source:MGI (curated);Acc:Cops2-001]

 
Come back to gene ENSMUSG00000027206


For any suggestions or comments, please send an email to unitrap@crg.es