Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D040C02
Clone ID D040C02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD040C02
Sequence
GATCCTCTAGTGCCTCAACCCTTTTAGTTTCTTTTTGCTGTCTCCACACCTTGCGGACAGAGATTCCCTGTCACACTGAG
GATTTTACTTGCCCAAGAGAAACTTGCCTAACACAGGTCAAATAGACTTGCCCTTTAACCCCAACTCCCCGAATCGTGCC
CCTCCGTGCCCATCTCTGCCAGGACAGTTGACAACCCTTGCAGACTTGGTAGATTTCAGAGAGCGCCGTGGGGCTGGCTT
TTGACCTCTTCTTTCTGGAGCAAATGTGTTATGAGTGTTGCGAATGGAATGAGTTGGGGTGGGTCCGCACCTGCTCCCGA
AATGGCCCACTTTCCACTTGAGCAGCTGGATTTTCTAAGGCGGCACTGGGGACAA
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12363757..12364131 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]


SPLK-Sequence tag 3SD040C02
Sequence
GTCCCACTGACTCACCCGATCCCTTGCCCANNGACTTTGTTGCCCAAGTGTTTATAAAAGCCGTCTAAACCAGTTCTTTA
TTCTTAAAATCTCCCCTGGAGGCTTCCAAAAAAGTAAGATACATTTCTAACTCATAATCTTGAAGCTACGGAATTTTTTT
TTTAAGACTTTTCTTCGCTAAGGTGTGGTTGTGGTTATATAAATCCTTTGAAGAAACAAATTCCCCTTAAAAAATAGATA
TGGGAATACTTTTTCATGGAAATGGAGAGCCCCTAAAATGACGTTGGGAGATGTAAACAGAATTGCTTTTAAAATTGCGA
CTTTTCTACATTGTTACATAACTCTATTTAAGGGGACTGAATTATTTCACCAC
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12363359..12363731 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es