Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D040B05
Clone ID D040B05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D040B05
Sequence
TCCGAANNNCGTGCGGAGCNNNTATNNNCNNGCCGCCCGCCCCGGAGCAGAGTCCCGGGCCTTCCCGCCCGTGTTCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD040B05
Sequence
GATCTGGGTTCAATTCCCAGTGCCTACATTAGAATTGTCTGTAACTCAAATTTCAAGGGATTTGATACCTCTCTGGCTTC
CACGGGCATCAGGCTCACACATGCTACACAGACATACATTTAGGCAAAATGCCTATATGCATTTTTTTAAAAAAATAATA
ATGATTCAAGACTAGCTTGATCAATAGAACAAGTTCCAGGACAAACAGAGTTGCGCGCACACACACATACACACACC
Sequence Type genomic DNA
Unitrap ID UNI29909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4316420..4316659 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040028 (Elavl1) NM_010485 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene [Source:MGI Symbol;Acc:MGI:1100851]


SPLK-Sequence tag 3SD040B05
Sequence
AATGATGAAAAACTATTTCTTACTTCTTTTTAAATACTTTTCTCAGGCTTTGGGTATTCTAGCGTTGTCTTGCAAACACA
GTTTAACATTTTGATGACACCTATTTTTTTTTAATGAAAACAGCTTTTGGGGGTATATCTAAGAATTCTTTGCACAGTAC
AGTG
Sequence Type genomic DNA
Unitrap ID UNI29909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4316226..4316394 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040028 (Elavl1) NM_010485 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene [Source:MGI Symbol;Acc:MGI:1100851]

 
Come back to gene ENSMUSG00000040028


For any suggestions or comments, please send an email to unitrap@crg.es