Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D039E05
Clone ID D039E05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD039E05
Sequence
GGGATCCGGCCTGGTTTTGGGGGCGGAGGGGGGGTGGCGATGGGGTGGAGCTGCCCCAAACTCCCCCATGTGGCCCTCGG
TTTGGAGTGCGGAGGATTAATTTGTTCCGGGTGGGAGGTAGAGAAGCGAATGGCCCCATGGGCTCTAGATGTGGCGCGGA
GGGGGGTGAGTCTCCCATCCTCCGCGCGTGGGCTTCTGTCCTCTCTGTTCATTTCCAGCCTCTTTGTCAGCTCCTCTTAT
TACCCTGCCTTCTTTCTTACCGACCCTGGTCGTGGAATATATTTTCGCTGCAGTCTTTGACTTCCTGTTGTCTATACTGT
AGTTTTGGCTACCCAAGCAGTTATCTTATTTGGGAAGCTGGACATGGAGGCCCCCGTGGATTGTGTTGCGCCTAAGGGAT
GTCACTAGACTGGGCATTTGTTCATTTTTCTCATAATGGGAATGGAATTCCAAATTTCTTGAGACCCTTCACCTGGTGGA
CAGCCCCTAAATTTTTTGCAAAGTGAT
Sequence Type genomic DNA
Unitrap ID UNI18328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855368..89855874 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]


SPLK-Sequence tag 3SD039E05
Sequence
AATTTAGCAACCTCTGGTGTAGGTTGTTGTGGAAAGAAAAAACAGTTAAAGGCGATTTTGTTAAATTTGTTTTTGCCTTT
GACTCACTGACTACTAAATGGAGAGATTATTTTTTGTCTCCACCTCCCATATTATGCGTTGGGGATATCTGCTGTGTCTT
GCTGGGAGGGGGGTATGAGTCAGTTTGACAACCAGCATTAGAGATTAAAATATTTGGATGTGTATCTGTTGATAAGACTG
TGTTGTGGGTCCCATTCGAGTGGCCTCCAGTATCGATCATCCCCATGATTGTTTCTGATGTGAATGGGAGATACTGCTGT
CATGTAAAATAGTGAGGAAGGGCTAAATGTACTGGCTTTCCCCAGTGTTTCTAACTGGGAAGACTCCTATTAGATTGAAG
GTGGTTGGGGAATGGGACACAGGTCTAGGAAAATTAGTTTCTCTGTTAGAAGTGGTAAGCCTTACCCATCCCAGTCCAAC
TTCAGAATGTCTGA
Sequence Type genomic DNA
Unitrap ID UNI18328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89854839..89855332 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es