Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D039D12
Clone ID D039D12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD039D12
Sequence
TTTTGCTTATTCGATTTTTTCTGCCAGCAGAATTGTTTNNCAGAGCCTGTGTGGGGGCTATGTAAGGAATAGATGGAATA
TTTTGCATCCAGGGGTTCTGTGGAGCCCCTGTTGTTTAGTAAGGCTTAGTCTGGCACCAGCTCCTGGTCTGAGAGCAAGC
TCATAAAAATCCTTAAGCTCCCAGCATACCTTCCTTCAAACCTCCCAGATGGGACTTAAGGCTGCTGGGAATGAAACCTG
GGACACAGGGCCCTGGGGCGTGATTAGGGAGCTGGTGTCTAATAGGTTGACAATCTGAAGTTCTTGTACTTGCTCGATAN
NNTTGTGTACCTCATTCTGGTTTTCTCTGGGGCTTTGACTTGGTTGTTCAATTTAATCGTATGTCTCTGAAATTATTTTG
GAGGAGTGTAAGATTAGTTGCCATTTCTAAATGGCACAAAGGATAGATGGGTAAGATACTAGGTTGCTACTTGGTTTTCT
TTGTTGGGATATGTCANNNGGAAGGGGGCTGTGGAAGCCAAGTGGATGGTGGTTGCTTAAGAGACTGTAGTGTTTTACAC
AAGCCAGAGAACCAAGTATTTGGGCCCTAAAGAGAATGCAGAGAGCTTCTAAGCTTTTGTCTGAAAGGGGCAGAACCTGA
ACTGCCTACTGTCTGGCCCACAGGCACCGGCTCGTTTTGGGGGAGGTGCCTGCAGGACCCAACGTACTCAATGAGCTTCC
AGCGCAATGTCCGATCGCT
Sequence Type genomic DNA
Unitrap ID UNI29501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35299916..35300654 713
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

 
Come back to gene ENSMUSG00000024393


For any suggestions or comments, please send an email to unitrap@crg.es