Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D039A05
Clone ID D039A05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD039A05
Sequence
AGGGTTTCTGAACATTGTCCGGGACAGCCGGGCAGTTGAGCGCACAGTGGTGTGAAGCCAAGGCTACTAGTACCTAGGTA
TCTAGGAGCCCAGAGAGGATGGGTTGGAGTTCTTTGTTGGGTTACCTACTGCACTCACCTGAGTGACTGAACCATTCTGT
CTTCCCATACTTGTGTACTAGGGTGGAAACCAGGAGTCTACATTTGACTGGAGGGAGACTGATGGCTGCTGCCCTTCCAT
AGTCAGGCTCACTCTAGTGTAAAGCCCCGGCTGCGGCTGCCGGTTACCTACCTCCTTTGTGGGCAGTGGAGGCCAGCTCC
AAACCACCTGCTGAGG
Sequence Type genomic DNA
Unitrap ID UNI2641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27371196..27371531 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026917 (Wdr5) NP_543124 WD repeat domain 5 Gene [Source:MGI (curated);Acc:Wdr5-001]

 
Come back to gene ENSMUSG00000026917


For any suggestions or comments, please send an email to unitrap@crg.es