Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D038C06
Clone ID D038C06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD038C06
Sequence
GCACCCCTTAAGCTCGTCTCTGCCTCAGCCTCTGAAACTGCGGCAGCAAAAAGCGNNTAGCGCGCCCGGCTTGCGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD038C06
Sequence
GGCTCCNATAGACTCGCGTTTAAGGCACTTGCTGCCAGGTCTGAAGACACAGTTTCAGTTCTCAGAAGCTATATGGTGGA
AGGAGAGAACTA
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52182574..52182648 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es