Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D037G10
Clone ID D037G10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD037G10
Sequence
TCACTCAATGCAAAAATACATATTTATTGTAGGTAATCAGGGAAGAAAACAATCAACTTGTTGTCTGTCCTTCTAGTCAT
ACATACATGCAGAACATACATGTCATAGGTAGTTAGCTCTGATGTCAACCCGGACAGAAACCTGGTTCTATTTATTGGAT
GCTTTATAAAAACCTGTTATGTCCTACCTGTATTATCTGCCATTGCTTACTCCTCAAGATAGCTTCCCCCTCTTTCTCTT
TCTCT
Sequence Type genomic DNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54055887..54056130 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es