Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D037A09
Clone ID D037A09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD037A09
Sequence
GGTCCTTAGAACTGACATTGGGACTGACACCAGAACCTTGGGTCAGCTGTGGAAGCTTTCTTGCTGATCTACATCAGCTC
CCTGCTCTCTCCT
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92506981..92507073 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]


SPLK-Sequence tag 3SD037A09
Sequence
CAGTAATGTTAAGTAATCTGGTTGGAGTCCAGGACCTCAGACTAGGCAAACTAGCTAAAATCCCTGGTCACTTTTCATAC
TTTTGATCTTTATTCTAAAACCATATTTCTCTTTAGCCTTTTTTTTTCTTTTTTCCCTTTAAGATACTATATAGATGAGG
CGGCCTCAAACTCACGGGGCTGGTGTTAAAGGGGTGCCATCAATCTTGCCAGTCTAGCTTTGTGAAAATGCATGCAT
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92506087..92506323 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es