Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D036H02
Clone ID D036H02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D036H02
Sequence
CCAGCGCTCGTCTGCGGAGCGGGGTTGAAAGACACACAGAAGTCTTCATGGATATAGTTGATACATTTAATCATTTAATT
CCTACTGAACACTTAGATGATGCCCTATTTCTAGGATCCAACCTGGAGAATGAAGTCTGTGAGGATTTTAGTACAAGTCA
AAATGTCTTAGAGGACTCGCTGAAGAACATGCTCAGCGATAAGGATCCTATGCTAGGATCTGCAAGTAACCAGTTCTGTT
TGCCTGTTTTGGATAGCAATGATCCCAATTTCCAGATGCCTTGTTCAACAG
Sequence Type mRNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30919832..30930443 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 5SD036H02
Sequence
TGTACACAGGTGCCTTCTGTTGGGACTCACCATTGTTAATATTTGGTTCTGTTTGCTTTACTCATGTATGAAGTTTTCGA
GTTCACCCTCTGCAGCTGTAAGATATCGCACAGGAAGGGCTCAGGAACAATTCTGTACCTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30902022..30902166 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 3SD036H02
Sequence
CTTATCCTTCCTTAGCCTTCAGGTCAATGCTTTTTGAAAACAGTAAGACTTATCCCAAGAATGGGCTACATTACAGGCAT
TTCCCACTGTTTGACGGAGGTGAGGTGATCTGGCTTGTCGTAGTCCTTTACTTTCTTCAAAGTGAAAGTGAGGATTAAAG
GCTTGACTAGAGTTCAGGTTAAATATCTCTACGAGAGTTCTTCATGGGTGAAAGAAACTTCAGTTAATGTATAATGTAAA
GAAATCTTACTGTGTTTGATGGTGGAACTCTTTATGTTAAATTGGTTTACTAGGCTACAGTGTTGAGAGAGAAATCTCGT
CTTTAGGACTTCACTATATCTTGCATTGGTTACTATCATGCATGGTTACTCCCAATTTCAATGTGAAAGATTTCCTG
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30901283..30901679 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es