Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D036C06
Clone ID D036C06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D036C06
Sequence
TATTGGGAGGGCCTATGTCGGTGTGCAGGTGCCTTCGGTCGGGTTGAACCCAGAGCAAGCTGTGCTTGGTCTCCTGGCGT
CCCCNNGGCCGCTCCGGANNCTCACG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD036C06
Sequence
TACAGTCCATGATCCCATTTCTACCAAGTCTAATCAGTATTTTTAAGTGAGACCCATACAATTATAGATG
Sequence Type genomic DNA
Unitrap ID UNI15165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138531870..138531939 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]


SPLK-Sequence tag 3SD036C06
Sequence
ATTGGTTTGCTCTGAGGATATAGCTCAGTACTACAGCATGTACTCTGGTTGTGGTTCCCAGCCTTGTATAGCGTAAAAGT
TAACTTAACCTAAAAAGCTCTTGCTTTAACTCATTGTGAAACAGTTAGATGGTCAATTTACAAAGCCTTTTGTTTTTGCT
TTGTTGGGCTTTTCAATTAGTTTTAAGTCATGCTAACTTATTTCTTTGTGTGCAGTCAGGTGAGTGTGTGGAGTACAGCT
TCCAGAAACCTGTTCTTTCCACCATGCCGGTCGCAGGG
Sequence Type genomic DNA
Unitrap ID UNI15165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138531958..138532235 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es