Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D036B11
Clone ID D036B11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD036B11
Sequence
GCGTTTTCTTTAAAGTTCTTTGGCCGTTCCACCTCGCTCTTTCTGTATTCAAATAGCCCTCCTTTACTTTATAACTATTT
GCTTTTTGTTTTGGGGAACTCCGCCCTCATTTCTGTTAAGTCCTCATTGAAAAGACAAGGAAGCTGTCAGGCATCCAGGA
GGCGTTGTTAACTTCTAGATGAGAAAGTTTCTGTCCTTNNNTNGTCTGTCGGAGCTNNNAGTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD036B11
Sequence
ACCCCCAAGGCTGAGCCTTGCCCAATTTACTACAGCCTTGCCTAGTTTACTGTATGACTTTCTGAAGCATGAGCTTTCCC
TGTTACTGTTCTGTGAAGTGACTTCGGATGTATTTTAAAGTCCAATAAAGCTGGTGTACGTAACCTTAGATGAGTATGGA
TTGACACATGTGGGTCGTGTCCTCACTGCTGCTGCTTCTCCTGTTTTAGGTGTGATTTCCTTCAGTACAGCACGGCACCG
TGGAAGTGCAGACTCTCACAGGGGGTGTGGTCTCTGCTCACACAGGTGAGCTCACCTTCAGATAAAATTTTGTGTGCTGA
TGTTAATGGGAGAAACTGTATGACATGATGAGAGAATAGGTTGNNNATGATTACTGCATGTGTTTTCTATGTAGGGTTTG
GTGATAGTACAACCAAACTGAGGCTGGATAAGNNNNNNTGTTACCCNNNCACTACTAGGGAGAGCACTAAGNNNATTAGG
GTTTTC
Sequence Type genomic DNA
Unitrap ID UNI30289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134657470..134657955 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es