Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D035C07
Clone ID D035C07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D035C07
Sequence
ACAGCGTCGCCAAGCAGGTAGGGCCTTCCTGAGGACCCCTATCTTACAATTGTATACCTTAGAGGAAGTGATCAAATTCA
AACTCGAGGCTAGGCTTATTCTATATNCTATCTAGCAGACCTGNNNACTGCAGTGGCCGTGGGGCTGCAAAACCCCGCCT
TCCTTGAGGGGACATGGTCGTCAAGCAG
Sequence Type mRNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21975860..21988419 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


SPLK-Sequence tag 5SD035C07
Sequence
TGAGGCTGTACATCCAACTTATTTTTCTAGGTAACAATAGATTCTGTGGGCATCATCTCTCAAGACTTCTATCACCTGAT
CACCTCCCATCCCCCCCTTCTGAGACAGGTCTAAACATATACCCTAGTTTGGCCTGGAACTTGAACTTCTTCTGCCCCTG
TGTGACTGGGATTCTCACCCTATGCCACCCAGCCCAATATTTTCTTAGAATAACTGACTGTTAG
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22005433..22005656 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


SPLK-Sequence tag 3SD035C07
Sequence
TTCTGATGATTTTACTTTCCTGAGAATCTCCAATGCTGATTGCTGATTTTATTTCACTGTTCTCACATCTGTTAGGCCAG
TTTGTTTGATAATATTCAAATCTTTTATTTAGCATTTCCTGATTTTTCTGTTCCCTCTTTAGTCAGTAACAGAGAATAAG
ATACTTAACTTGCTCGGCCCTAAGTTCTGTTTCTTTGTGGAACTTTGTTTTTGCTTTATTGATTTTGAAGTAATAGGATG
AGGTTTATGAACGCTTAGTGTTTTGTTTTTCCTCTGTGTTGTGGTGGCCCTTTATTATTACTTTTTTACCGTGCTCATAT
TCTGTGCTCTGACAGTCTGTGTACCTGATGTTTCTGCTGTCATTTCATCTCTCTCTGTAGTGGAGCTGGCATGGTCTGTG
TGTTTCCCTCTTGATTTGTTTTCAGTCTGATTATATGTGAGGTCTGCTTATGTATGATGTGGAGTGGTCTTGCTTGTTGA
GCTAGTTTCCCTCTCTGCTTTGGATTAATAGAAACACTTCATTGTACCGGCTTACTGCTTTAGGCTGTTAGGTCAAGCTC
TATGGTGTAGGCGTTTAAACTCACCACCCACCTTGAAGTGCTACTTAAGGGCTTACCATTCTCCTCACCCCATTATCCAC
TGTATGGTAAATGG
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22005673..22006327 651
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es