Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0076
Clone ID CE0076
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0076
Sequence
AAGGCAGCTAGTTAGCAGGCCACCTGTCATCTTGTGGGAAAGACTAATTCCAGGGTGTTCCAGAAGTATCTACAGTGCCA
CCGGGAAGTGGACAAAGGAGTACACACTGCAGACAAGGAAGGATGTGGAGAAGTGGTGGCACCAACAGATAAAGGAGCAA
GCGTCCAGAGTCTCAGAGGAAGATAAATTAAAGCCCAAATTCTACTTGCTCTCCATGTTCCCATACCCTTCTGGCAAGCT
GCACATGGGCCATGTCCGTGTCTACACCCTCAGCGACACCATTGCACGGTTCCAGAAAATGAGAGGCATGCAG
Sequence Type mRNA
Unitrap ID UNI1212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123281038..123286947 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035202 (Lars2) NM_153168 leucyl-tRNA synthetase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2142973]

 
Come back to gene ENSMUSG00000035202


For any suggestions or comments, please send an email to unitrap@crg.es