Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D034H10
Clone ID D034H10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD034H10
Sequence
CTGATCATTTTCCNTCGTAGATTTTAGTCAGGGCTGTTAGCCCTTGGGTNNTGGCTGANNGNGCCAAAAGAAATCAGGAA
GGAGGCTGGCTCTAGGTAACTCGGAAGGTCTCTGCAGCTTGGAGATGATAAAATCGCATGTGTGCTTGGGATGTTTAGTG
TATGCCCCAGCTCCTGTTTGTAAATAGGGCAGGTCCCCTTGTATAAAGCTGGTGTTATTATTCACCCCCATAGAACAAAC
ACCTCCACCCCCCTGTTGTTGTCTTAAAAAACTCCAGCTGCTCATGAATATAGGGTCAGGGAGGGCTGGCTAAATGTTTC
TCTGTGCTCTCTCTCCAGCACTGCCGGCCGGGCTGTTTCCTGTTCTTTGTTTCAAGGCTGGGGTTCGCGTCATTCATTCC
AAGTGGCATATGTGTGCTCTTTCCTGTTTCAGGCGGTCATCTGGTCGATCAGTAGCCTAAACCAGGCCATGGTCCCTGCC
CCTAAACTTTGTATCCCCACCCAGGGAGCTATCATGTCTCTACACTGTGATTGCTCAAGATGCCTGTGTTATGTCATAAT
TGAGAAGTCAGTTACCATTGTAATATACAACCTTTGCCCCACTGTTAAAGGGGCAAAGCGATACTTTTTACCTTTTAAAA
GTTATCCCGCTGATGGGATGTTAGGGATTTTGTGGGCATATGGAC
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65197167..65197851 639
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 3SD034H10
Sequence
GTTTTTGCAGTTTTCCTGTGAAGTGGATACAGCCATTGTCGGGAGATAGGCACACTGCCCTGGAGCTGTCAAGTTTAGAT
CAGGATTAACACCTTGGAGTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65197868..65197973 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es