Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D034B06
Clone ID D034B06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD034B06
Sequence
GATCTGTGGCCGAAGGACCGTCACCACATAACTTCAAAAATAATCAACCACCTTCCCTGCCCAAACCTACCCAATCTCAC
TCATCCAGCATTTCCGTTTTGGAATCCACTCAGACTTTTTTTTTCAACGACCCCCTCTCCCTAAATGGAGTTGGGCGGGG
GGGAAATGAAAACTGAGTTGGTCTTTACTTTTTTTAAAAGAGACTTTTTGATCCAATGAGGCCCCACAAGTAACTGAGTT
TGGGTCCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTACCCCTCCCCCCTGAGCCCGAGGTGCTGACGTCGCAA
AAAAATTGGATAGTAAGTGTCGAATTTTCAAAAACCAGCCTTGAACAAGAAATCAACGTTTCCCGTTGTGAAACCAAAAA
TAATGAGAGGAAGAAATGAGACCATAGAACAAATGTAGAGTACTGGAGAGAAGGACCAATCGGGTCTCTTAAATCTCCAT
TAAAG
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054330..36054814 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


SPLK-Sequence tag 3SD034B06
Sequence
CTTTGTTCTCTCTCCCCTACACCTGCCTCTTCCCTGCTGTGGAGCAGGCAAGGGAGAGGGTGAAGGGAGGGCCAGCCAGT
GAGGATTTTGACGGTTAACCCTTGATAATCCAGCAGATTTCCAGACTGCCAGAGCATAAGCCTTTGCGATAATAAGGAGG
AATGGTTACCTTCCTCTGGTTAGCAGTCTTCAAAAGGGTTAATGAGCTCACATACAAAAGATGGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054835..36055062 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000084751 (mmu-mir-1894) mmu-mir-1894 [Source:miRBase;Acc:MI0008326]

 
Come back to gene ENSMUSG00000084751


For any suggestions or comments, please send an email to unitrap@crg.es