Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D034A06
Clone ID D034A06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD034A06
Sequence
CCCGGCTGCCTGGTTCGCGCTGTAACCTCGCGCTTCCCGGGTGGCGGGAAGGGGGTGTTTCTAGG
Sequence Type genomic DNA
Unitrap ID UNI30070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123060365..123060429 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es