Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D034A04
Clone ID D034A04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD034A04
Sequence
CCTCGTGCTCTGTGTGAGGGNNNATCTGCAGTCGTCTCTAAAGGGACTAAATAAAACTTTTTGTAGTATAAAAACTAGTT
TTGTTATTTTCAAGTTCTGGTGTTATCTTTTGTTTTAAACACTAGAAAGTTCTTAAAATTTACATTCTTAGAAATATGTA
ATCACATGTTTGATCATTTTTAAGCTTCTTAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD034A04
Sequence
AGTATGTCTTCAAAGTCAGGCCGAGTGAGGGCTTTGGGTTGTAGATACAGTGCCATGGAATTGTTAATCACTAAACGATT
GGGAAGGTGGTAATTTAGGATGATTCAGATGTCCTTAAGGTCTAATTTATTGTGCAGTGGTTATAAACTGACCCTCCAGA
GAGCCAGTACTCGAGTGCTTTGTTAACTTCCTAATAAGCTGTTAAAGTATGGACTGGAGACATAGGTCAGTGGGGTTAAG
GGTGCTTGAAGCATGAAG
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152070979..152071236 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es