Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D033E06
Clone ID D033E06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD033E06
Sequence
GATCTCCCTCCGTGCGCAATAAGTAGGCTGGAGCGTTGCGCAATTTTCTGGTACCTAGTGTTTGACCAATAGTACATGCC
TCGTAACTGTTAATGCTGTATTAATAAATGATAAGTCACTTTACTGTGCATATTAGGACTGGTGTGCCTCACGATCGTAG
GTTACCTTAGTAGGGGTATGTATATCAGGTTCTGAAACTCGTATTTTCCTGATGTGAGTTTTGATAAAATCCTGAATTAG
AAGTGGGGTGTGGTGTCGAAAGCTGCACTCACAGCACTTGGGAGGTAAGGCAGGAGATACATGAGATTCCGTCTCAAAAA
CAAGAAAAAGGAAAAGTCCAGAATTAGGATGTCATTGGGCACCATTTGGAATCTGGGAGAAGAGAGCATGAAATATCTAT
CCACTTCTGTAGTTCGAGGCGATCAAGGTAAGTCAAATTGAAATAACATTGATG
Sequence Type genomic DNA
Unitrap ID UNI6854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280420..90280873 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]


SPLK-Sequence tag 3SD033E06
Sequence
CTTTTTCAGCGATTGAGAGAAAATGTATGTATTTTTAGGGGTGACAGANNGAGGACTCCTGCCTCANNGCTCTGCATCCA
GAGTAGGGCCTGGCGATAGCAGAGCGTGGCTGCTTGCATCTTTGCCTTGGTTTGCTTCAGGAGAAAGGAGGTTGGAGCAG
ATTGATCTATTTCATTTCACGAAAGTCACGAAAAGCATTTCTTTTCCTGATGTCCTACTAAGCGCAGCTGACCTGTTGCT
AGGAATGATACAGCTCAGAAACTTTTCCGATTCTTAAGACAGAATTGGGCGCCGCATTGTGTACCTCTCTAGAGCTATAC
TGCTTGTATAACTCTGGGCTGCTTTCATGTCTCAGGGTCAGGCCTTCTGTGCCCCATATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es