Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D033E04
Clone ID D033E04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD033E04
Sequence
GATCCTTGCTGTGAGGGAAATTCTCAAGCCAGCTCGCAGAGAAGATTGCTTAAATAATGCAAGAGCAGGAGAGAGGCGAG
ATGGAATTTATGGCCCA
Sequence Type genomic DNA
Unitrap ID UNI30296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71931554..71931650 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049044 (Rapgef4) NM_019688 Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI (curated);Acc:Rapgef4-003]

 
Come back to gene ENSMUSG00000049044


For any suggestions or comments, please send an email to unitrap@crg.es