Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D033A11
Clone ID D033A11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D033A11
Sequence
CGGGCGCGTGAGCGGAGGCTTTGGCTGCAGGGGAAGGAGGACTATGAAGCTTCCGAATATCCTGCTCTCCGGTACGCCAG
GGGTTGGAAAAGCCACACTAGGCAAAGAACTTGCATCAAGATCAGGCCTGAAGTACGTTAACGTGGGAGATCTAGCTCGA
GAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101421330..101424238 90
 
EST/CDNA Est Name
  BC108348.1


SPLK-Sequence tag 5SD033A11
Sequence
TTTTAGTTCCATTTTTAAATGGAACCTTTTTGGTCA
Sequence Type genomic DNA
Unitrap ID UNI27420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101426729..101426764 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]


SPLK-Sequence tag 3SD033A11
Sequence
TTCCTGTAAGAAAGGGCACTGCACTGGGCTGNNCTGGGTGTCTGGGGCCTGTGGAGGCCAAATGAGGGCTCCAAATCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es